pcag gfp vector Search Results


99
Integrated DNA Technologies pcag cas9 ires gfp vector
Rpl29 methylation shows no effect on global protein synthesis. A, Western blotting showing the absence of Rpl29 in Rpl29−/− NIH 3T3 clones generated by <t>CRISPR-Cas9.</t> B, exogenous Rpl29 or the K5R mutant (untagged) was stably expressed in Rpl29−/− NIH 3T3 cells, and the cell lysates were immunoblotted with Rpl29 antibody and D8T9P, respectively. C, SUnSET assay showing global protein synthesis in the indicated cell lines. As a control for protein synthesis inhibition, NIH 3T3 cells were treated with cycloheximide (CHX, 100 μg/ml) for 12 h before the addition of puromycin. D, [35S]methionine labeling assay showing global protein synthesis in the indicated cell lines. Shown are the mean ± S.D. from three independent experiments. The significance of differences was determined with one-way analysis of variance (ANOVA). *, p < 0.05; ns, not significant. E, polysome profiling showing similar fractions of mRNPs and polysomes in all cell lines.
Pcag Cas9 Ires Gfp Vector, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcag cas9 ires gfp vector/product/Integrated DNA Technologies
Average 99 stars, based on 1 article reviews
pcag cas9 ires gfp vector - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

94
Addgene inc gfp fragment
Rpl29 methylation shows no effect on global protein synthesis. A, Western blotting showing the absence of Rpl29 in Rpl29−/− NIH 3T3 clones generated by <t>CRISPR-Cas9.</t> B, exogenous Rpl29 or the K5R mutant (untagged) was stably expressed in Rpl29−/− NIH 3T3 cells, and the cell lysates were immunoblotted with Rpl29 antibody and D8T9P, respectively. C, SUnSET assay showing global protein synthesis in the indicated cell lines. As a control for protein synthesis inhibition, NIH 3T3 cells were treated with cycloheximide (CHX, 100 μg/ml) for 12 h before the addition of puromycin. D, [35S]methionine labeling assay showing global protein synthesis in the indicated cell lines. Shown are the mean ± S.D. from three independent experiments. The significance of differences was determined with one-way analysis of variance (ANOVA). *, p < 0.05; ns, not significant. E, polysome profiling showing similar fractions of mRNPs and polysomes in all cell lines.
Gfp Fragment, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gfp fragment/product/Addgene inc
Average 94 stars, based on 1 article reviews
gfp fragment - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

95
Addgene inc pcag vector
Rpl29 methylation shows no effect on global protein synthesis. A, Western blotting showing the absence of Rpl29 in Rpl29−/− NIH 3T3 clones generated by <t>CRISPR-Cas9.</t> B, exogenous Rpl29 or the K5R mutant (untagged) was stably expressed in Rpl29−/− NIH 3T3 cells, and the cell lysates were immunoblotted with Rpl29 antibody and D8T9P, respectively. C, SUnSET assay showing global protein synthesis in the indicated cell lines. As a control for protein synthesis inhibition, NIH 3T3 cells were treated with cycloheximide (CHX, 100 μg/ml) for 12 h before the addition of puromycin. D, [35S]methionine labeling assay showing global protein synthesis in the indicated cell lines. Shown are the mean ± S.D. from three independent experiments. The significance of differences was determined with one-way analysis of variance (ANOVA). *, p < 0.05; ns, not significant. E, polysome profiling showing similar fractions of mRNPs and polysomes in all cell lines.
Pcag Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcag vector/product/Addgene inc
Average 95 stars, based on 1 article reviews
pcag vector - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

94
OriGene pcas guide ef1a gfp vector
Rpl29 methylation shows no effect on global protein synthesis. A, Western blotting showing the absence of Rpl29 in Rpl29−/− NIH 3T3 clones generated by <t>CRISPR-Cas9.</t> B, exogenous Rpl29 or the K5R mutant (untagged) was stably expressed in Rpl29−/− NIH 3T3 cells, and the cell lysates were immunoblotted with Rpl29 antibody and D8T9P, respectively. C, SUnSET assay showing global protein synthesis in the indicated cell lines. As a control for protein synthesis inhibition, NIH 3T3 cells were treated with cycloheximide (CHX, 100 μg/ml) for 12 h before the addition of puromycin. D, [35S]methionine labeling assay showing global protein synthesis in the indicated cell lines. Shown are the mean ± S.D. from three independent experiments. The significance of differences was determined with one-way analysis of variance (ANOVA). *, p < 0.05; ns, not significant. E, polysome profiling showing similar fractions of mRNPs and polysomes in all cell lines.
Pcas Guide Ef1a Gfp Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcas guide ef1a gfp vector/product/OriGene
Average 94 stars, based on 1 article reviews
pcas guide ef1a gfp vector - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

92
Addgene inc pcag dcas9 krab 2a gfp
Rpl29 methylation shows no effect on global protein synthesis. A, Western blotting showing the absence of Rpl29 in Rpl29−/− NIH 3T3 clones generated by <t>CRISPR-Cas9.</t> B, exogenous Rpl29 or the K5R mutant (untagged) was stably expressed in Rpl29−/− NIH 3T3 cells, and the cell lysates were immunoblotted with Rpl29 antibody and D8T9P, respectively. C, SUnSET assay showing global protein synthesis in the indicated cell lines. As a control for protein synthesis inhibition, NIH 3T3 cells were treated with cycloheximide (CHX, 100 μg/ml) for 12 h before the addition of puromycin. D, [35S]methionine labeling assay showing global protein synthesis in the indicated cell lines. Shown are the mean ± S.D. from three independent experiments. The significance of differences was determined with one-way analysis of variance (ANOVA). *, p < 0.05; ns, not significant. E, polysome profiling showing similar fractions of mRNPs and polysomes in all cell lines.
Pcag Dcas9 Krab 2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcag dcas9 krab 2a gfp/product/Addgene inc
Average 92 stars, based on 1 article reviews
pcag dcas9 krab 2a gfp - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

gfp  (OriGene)
94
OriGene gfp
Down-regulation <t>of</t> <t>MOV10</t> (Moloney Leukemia Virus 10) enhances Hepatitis B virus (HBV) gene expression in HepAD38 cells. ( A ) Time course of the experiment. HepAD38 cells were transfected with 50 nM siMOV10 or siControl 24 h before tetracycline (tet) removal. Cells were collected two days after tet removal. ( B ) Western blot showing HBV core and MOV10 expression in siRNA treated cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( C ) Quantification of HBV core expression determined by western blotting. ( D ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( E ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.
Gfp, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gfp/product/OriGene
Average 94 stars, based on 1 article reviews
gfp - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

95
Addgene inc pcag ires gfp vector
Down-regulation <t>of</t> <t>MOV10</t> (Moloney Leukemia Virus 10) enhances Hepatitis B virus (HBV) gene expression in HepAD38 cells. ( A ) Time course of the experiment. HepAD38 cells were transfected with 50 nM siMOV10 or siControl 24 h before tetracycline (tet) removal. Cells were collected two days after tet removal. ( B ) Western blot showing HBV core and MOV10 expression in siRNA treated cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( C ) Quantification of HBV core expression determined by western blotting. ( D ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( E ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.
Pcag Ires Gfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcag ires gfp vector/product/Addgene inc
Average 95 stars, based on 1 article reviews
pcag ires gfp vector - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

93
Addgene inc pcag cre gfp vector
Down-regulation <t>of</t> <t>MOV10</t> (Moloney Leukemia Virus 10) enhances Hepatitis B virus (HBV) gene expression in HepAD38 cells. ( A ) Time course of the experiment. HepAD38 cells were transfected with 50 nM siMOV10 or siControl 24 h before tetracycline (tet) removal. Cells were collected two days after tet removal. ( B ) Western blot showing HBV core and MOV10 expression in siRNA treated cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( C ) Quantification of HBV core expression determined by western blotting. ( D ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( E ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.
Pcag Cre Gfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcag cre gfp vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcag cre gfp vector - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

90
Addgene inc hoxb5 gfp reporter lentivirus
Down-regulation <t>of</t> <t>MOV10</t> (Moloney Leukemia Virus 10) enhances Hepatitis B virus (HBV) gene expression in HepAD38 cells. ( A ) Time course of the experiment. HepAD38 cells were transfected with 50 nM siMOV10 or siControl 24 h before tetracycline (tet) removal. Cells were collected two days after tet removal. ( B ) Western blot showing HBV core and MOV10 expression in siRNA treated cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( C ) Quantification of HBV core expression determined by western blotting. ( D ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( E ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.
Hoxb5 Gfp Reporter Lentivirus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hoxb5 gfp reporter lentivirus/product/Addgene inc
Average 90 stars, based on 1 article reviews
hoxb5 gfp reporter lentivirus - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

93
Addgene inc pca ires gfp vector
Down-regulation <t>of</t> <t>MOV10</t> (Moloney Leukemia Virus 10) enhances Hepatitis B virus (HBV) gene expression in HepAD38 cells. ( A ) Time course of the experiment. HepAD38 cells were transfected with 50 nM siMOV10 or siControl 24 h before tetracycline (tet) removal. Cells were collected two days after tet removal. ( B ) Western blot showing HBV core and MOV10 expression in siRNA treated cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( C ) Quantification of HBV core expression determined by western blotting. ( D ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( E ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.
Pca Ires Gfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pca ires gfp vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
pca ires gfp vector - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

91
Addgene inc lt1
Down-regulation <t>of</t> <t>MOV10</t> (Moloney Leukemia Virus 10) enhances Hepatitis B virus (HBV) gene expression in HepAD38 cells. ( A ) Time course of the experiment. HepAD38 cells were transfected with 50 nM siMOV10 or siControl 24 h before tetracycline (tet) removal. Cells were collected two days after tet removal. ( B ) Western blot showing HBV core and MOV10 expression in siRNA treated cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( C ) Quantification of HBV core expression determined by western blotting. ( D ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( E ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.
Lt1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lt1/product/Addgene inc
Average 91 stars, based on 1 article reviews
lt1 - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

95
OriGene pcas guide gfp expression vector
KEY RESOURCES TABLE
Pcas Guide Gfp Expression Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcas guide gfp expression vector/product/OriGene
Average 95 stars, based on 1 article reviews
pcas guide gfp expression vector - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

Image Search Results


Rpl29 methylation shows no effect on global protein synthesis. A, Western blotting showing the absence of Rpl29 in Rpl29−/− NIH 3T3 clones generated by CRISPR-Cas9. B, exogenous Rpl29 or the K5R mutant (untagged) was stably expressed in Rpl29−/− NIH 3T3 cells, and the cell lysates were immunoblotted with Rpl29 antibody and D8T9P, respectively. C, SUnSET assay showing global protein synthesis in the indicated cell lines. As a control for protein synthesis inhibition, NIH 3T3 cells were treated with cycloheximide (CHX, 100 μg/ml) for 12 h before the addition of puromycin. D, [35S]methionine labeling assay showing global protein synthesis in the indicated cell lines. Shown are the mean ± S.D. from three independent experiments. The significance of differences was determined with one-way analysis of variance (ANOVA). *, p < 0.05; ns, not significant. E, polysome profiling showing similar fractions of mRNPs and polysomes in all cell lines.

Journal: The Journal of Biological Chemistry

Article Title: Identification of Rpl29 as a major substrate of the lysine methyltransferase Set7/9

doi: 10.1074/jbc.RA118.002890

Figure Lengend Snippet: Rpl29 methylation shows no effect on global protein synthesis. A, Western blotting showing the absence of Rpl29 in Rpl29−/− NIH 3T3 clones generated by CRISPR-Cas9. B, exogenous Rpl29 or the K5R mutant (untagged) was stably expressed in Rpl29−/− NIH 3T3 cells, and the cell lysates were immunoblotted with Rpl29 antibody and D8T9P, respectively. C, SUnSET assay showing global protein synthesis in the indicated cell lines. As a control for protein synthesis inhibition, NIH 3T3 cells were treated with cycloheximide (CHX, 100 μg/ml) for 12 h before the addition of puromycin. D, [35S]methionine labeling assay showing global protein synthesis in the indicated cell lines. Shown are the mean ± S.D. from three independent experiments. The significance of differences was determined with one-way analysis of variance (ANOVA). *, p < 0.05; ns, not significant. E, polysome profiling showing similar fractions of mRNPs and polysomes in all cell lines.

Article Snippet: J1 mESCs or NIH 3T3 cells were transiently co-transfected with the pCAG-Cas9-IRES-GFP vector and two synthesized gBlocks (Integrated DNA Technologies) containing the U6 promoter and Rpl29 targeting sequences in intron 1 and exon 4, respectively ( Fig. S1 A ).

Techniques: Methylation, Western Blot, Clone Assay, Generated, CRISPR, Mutagenesis, Stable Transfection, Inhibition, Labeling

Down-regulation of MOV10 (Moloney Leukemia Virus 10) enhances Hepatitis B virus (HBV) gene expression in HepAD38 cells. ( A ) Time course of the experiment. HepAD38 cells were transfected with 50 nM siMOV10 or siControl 24 h before tetracycline (tet) removal. Cells were collected two days after tet removal. ( B ) Western blot showing HBV core and MOV10 expression in siRNA treated cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( C ) Quantification of HBV core expression determined by western blotting. ( D ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( E ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.

Journal: Viruses

Article Title: Effects of Moloney Leukemia Virus 10 Protein on Hepatitis B Virus Infection and Viral Replication

doi: 10.3390/v11070651

Figure Lengend Snippet: Down-regulation of MOV10 (Moloney Leukemia Virus 10) enhances Hepatitis B virus (HBV) gene expression in HepAD38 cells. ( A ) Time course of the experiment. HepAD38 cells were transfected with 50 nM siMOV10 or siControl 24 h before tetracycline (tet) removal. Cells were collected two days after tet removal. ( B ) Western blot showing HBV core and MOV10 expression in siRNA treated cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( C ) Quantification of HBV core expression determined by western blotting. ( D ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( E ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.

Article Snippet: The plasmid harboring Cas9, guide-RNA (gRNA), and GFP (pCas9-GFP-Mov10_T1) was purchased from OriGene Technologies.

Techniques: Expressing, Transfection, Western Blot, Quantitative RT-PCR, Standard Deviation, Two Tailed Test

Down-regulation of MOV10 enhances HBV gene expression in HepG2 cells. ( A ) Time course of the experiment. HepG2cells were transfected with 20 nM siMOV10 or siControl 24 h before transfection with pHBV plasmid. Cells were collected two days after HBV plasmid transfection. ( B ) Western blot showing HBV core and MOV10 expression in siRNA treated cells. GAPDH was used as a loading control. ( C ) Quantification of HBV core expression determined by western blotting. ( D ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( E ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.

Journal: Viruses

Article Title: Effects of Moloney Leukemia Virus 10 Protein on Hepatitis B Virus Infection and Viral Replication

doi: 10.3390/v11070651

Figure Lengend Snippet: Down-regulation of MOV10 enhances HBV gene expression in HepG2 cells. ( A ) Time course of the experiment. HepG2cells were transfected with 20 nM siMOV10 or siControl 24 h before transfection with pHBV plasmid. Cells were collected two days after HBV plasmid transfection. ( B ) Western blot showing HBV core and MOV10 expression in siRNA treated cells. GAPDH was used as a loading control. ( C ) Quantification of HBV core expression determined by western blotting. ( D ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( E ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.

Article Snippet: The plasmid harboring Cas9, guide-RNA (gRNA), and GFP (pCas9-GFP-Mov10_T1) was purchased from OriGene Technologies.

Techniques: Expressing, Transfection, Plasmid Preparation, Western Blot, Quantitative RT-PCR, Standard Deviation, Two Tailed Test

HBV gene expression in HepG2 MOV10-KO cells. ( A ) Western blot showing HBV core and MOV10 in HepG2 MOV10-KO cells compared to HepG2 parent cells. GAPDH was used as a loading control. ( B ) Quantification of HBV core expression determined by western blotting. ( C ) Intracellular HBV pgRNA level determined by qPCR after cDNA synthesis. Data were normalized to RPL18A mRNA expression. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.

Journal: Viruses

Article Title: Effects of Moloney Leukemia Virus 10 Protein on Hepatitis B Virus Infection and Viral Replication

doi: 10.3390/v11070651

Figure Lengend Snippet: HBV gene expression in HepG2 MOV10-KO cells. ( A ) Western blot showing HBV core and MOV10 in HepG2 MOV10-KO cells compared to HepG2 parent cells. GAPDH was used as a loading control. ( B ) Quantification of HBV core expression determined by western blotting. ( C ) Intracellular HBV pgRNA level determined by qPCR after cDNA synthesis. Data were normalized to RPL18A mRNA expression. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.

Article Snippet: The plasmid harboring Cas9, guide-RNA (gRNA), and GFP (pCas9-GFP-Mov10_T1) was purchased from OriGene Technologies.

Techniques: Expressing, Western Blot, Standard Deviation, Two Tailed Test

Down-regulation of MOV10 enhances HBV infection of HepG2-sodium taurocholate co-transporting polypeptide (NTCP) cells. HepG2-NTCP-C7 stable cell lines, shControl, and shMOV10, were infected with 250 HBV genome equivalents per cell. Five days later, cells were collected. ( A ) Western blotting showing MOV10 expression in shMOV10 stable cell line compared to shControl. GAPDH was used as a loading control. ( B ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( C ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from at least two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.

Journal: Viruses

Article Title: Effects of Moloney Leukemia Virus 10 Protein on Hepatitis B Virus Infection and Viral Replication

doi: 10.3390/v11070651

Figure Lengend Snippet: Down-regulation of MOV10 enhances HBV infection of HepG2-sodium taurocholate co-transporting polypeptide (NTCP) cells. HepG2-NTCP-C7 stable cell lines, shControl, and shMOV10, were infected with 250 HBV genome equivalents per cell. Five days later, cells were collected. ( A ) Western blotting showing MOV10 expression in shMOV10 stable cell line compared to shControl. GAPDH was used as a loading control. ( B ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA expression. ( C ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from at least two independent experiments. * p -value < 0.05, two-tailed unpaired t -test.

Article Snippet: The plasmid harboring Cas9, guide-RNA (gRNA), and GFP (pCas9-GFP-Mov10_T1) was purchased from OriGene Technologies.

Techniques: Infection, Stable Transfection, Western Blot, Expressing, Quantitative RT-PCR, Standard Deviation, Two Tailed Test

MOV10 over-expression diminishes HBV infection of HepG2-NTCP cells. HepG2-NTCP-3E8 parent cells and HepG2-NTCP-3E8 HA-MOV10 cells were infected with 400 HBV genome equivalents per cell. Five days later, cells were collected. ( A ) Western blot showing MOV10 expression in 3E8 HA-MOV10 stable cell line compared to HepG2-NTCP-3E8 parent cells. GAPDH was used as a loading control ( B ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA. ( C ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05.

Journal: Viruses

Article Title: Effects of Moloney Leukemia Virus 10 Protein on Hepatitis B Virus Infection and Viral Replication

doi: 10.3390/v11070651

Figure Lengend Snippet: MOV10 over-expression diminishes HBV infection of HepG2-NTCP cells. HepG2-NTCP-3E8 parent cells and HepG2-NTCP-3E8 HA-MOV10 cells were infected with 400 HBV genome equivalents per cell. Five days later, cells were collected. ( A ) Western blot showing MOV10 expression in 3E8 HA-MOV10 stable cell line compared to HepG2-NTCP-3E8 parent cells. GAPDH was used as a loading control ( B ) Intracellular HBV pgRNA level determined by RT-qPCR. Data were normalized to GAPDH mRNA. ( C ) Intracellular HBV DNA level determined by qPCR. Data represent mean ± standard deviation from two independent experiments. * p -value < 0.05.

Article Snippet: The plasmid harboring Cas9, guide-RNA (gRNA), and GFP (pCas9-GFP-Mov10_T1) was purchased from OriGene Technologies.

Techniques: Over Expression, Infection, Western Blot, Expressing, Stable Transfection, Quantitative RT-PCR, Standard Deviation

HBV pre-genomic RNA co-immunoprecipitated with MOV10. ( A ) HepG2-NTCP clone 7 cells were infected with HBV and harvested after five days. Immunoprecipitation was performed with an antibody against human MOV10 in the HBV-infected cells and in the non-infected control cells. SYBR Green-based RT-qPCR was done using primers against HBV pre-genomic RNA. ( B ) Human GAPDH mRNA co-immunoprecipitated with MOV10. SYBR Green-based RT-qPCR was done using primers against human GAPDH mRNA. ( n = two independent experiments, ** p = 0.0015, **** p < 0.0001, two-way ANOVA Sidak’s multiple comparisons test).

Journal: Viruses

Article Title: Effects of Moloney Leukemia Virus 10 Protein on Hepatitis B Virus Infection and Viral Replication

doi: 10.3390/v11070651

Figure Lengend Snippet: HBV pre-genomic RNA co-immunoprecipitated with MOV10. ( A ) HepG2-NTCP clone 7 cells were infected with HBV and harvested after five days. Immunoprecipitation was performed with an antibody against human MOV10 in the HBV-infected cells and in the non-infected control cells. SYBR Green-based RT-qPCR was done using primers against HBV pre-genomic RNA. ( B ) Human GAPDH mRNA co-immunoprecipitated with MOV10. SYBR Green-based RT-qPCR was done using primers against human GAPDH mRNA. ( n = two independent experiments, ** p = 0.0015, **** p < 0.0001, two-way ANOVA Sidak’s multiple comparisons test).

Article Snippet: The plasmid harboring Cas9, guide-RNA (gRNA), and GFP (pCas9-GFP-Mov10_T1) was purchased from OriGene Technologies.

Techniques: Immunoprecipitation, Infection, SYBR Green Assay, Quantitative RT-PCR

No specific interaction between MOV10 and HBV core protein. 293T cells were transfected with pC183 and peYFP-MOV10, pC183 and peYFP-empty, peYFP-MOV10 and peYFP-empty, or peYFP-empty only. Where indicated, lysates were pre-treated with RNase A prior to immunoprecipitation with the indicated antibodies. Immunoprecipitates were analyzed by western blotting using the indicated antibodies. ( A ) Proteins in lysates were immunoprecipitated with the anti-HBV core antibody. Immunoprecipitates were analyzed by western blotting using the anti-MOV10 and anti-HBV core antibodies. ( B ) Proteins in lysates were immunoprecipitated with the anti-MOV10 antibody. Immunoprecipitates were analyzed by western blotting using anti-MOV10 and anti-HBV core antibodies. ( C ) Western blotting showing detectable levels of MOV10 and HBV core proteins in tested lysates.

Journal: Viruses

Article Title: Effects of Moloney Leukemia Virus 10 Protein on Hepatitis B Virus Infection and Viral Replication

doi: 10.3390/v11070651

Figure Lengend Snippet: No specific interaction between MOV10 and HBV core protein. 293T cells were transfected with pC183 and peYFP-MOV10, pC183 and peYFP-empty, peYFP-MOV10 and peYFP-empty, or peYFP-empty only. Where indicated, lysates were pre-treated with RNase A prior to immunoprecipitation with the indicated antibodies. Immunoprecipitates were analyzed by western blotting using the indicated antibodies. ( A ) Proteins in lysates were immunoprecipitated with the anti-HBV core antibody. Immunoprecipitates were analyzed by western blotting using the anti-MOV10 and anti-HBV core antibodies. ( B ) Proteins in lysates were immunoprecipitated with the anti-MOV10 antibody. Immunoprecipitates were analyzed by western blotting using anti-MOV10 and anti-HBV core antibodies. ( C ) Western blotting showing detectable levels of MOV10 and HBV core proteins in tested lysates.

Article Snippet: The plasmid harboring Cas9, guide-RNA (gRNA), and GFP (pCas9-GFP-Mov10_T1) was purchased from OriGene Technologies.

Techniques: Transfection, Immunoprecipitation, Western Blot

MOV10 over-expression does not induce the degradation of HBV pgRNA. 293T cells were transfected with HBV core-deficient plasmid (Cp-deficient pHBV) and peYFP-MOV10 or peYFP-empty (eYFP) plasmids. After 48 h, the cells were treated with 5 µg/mL Actinomycin D. The cells were harvested at 0, 2, 4, 6 h after Actinomycin D treatment. Total RNA was extracted and HBV pgRNA levels were determined relative to the 0 h time point. RPL18A mRNA was used as a normalization control. Single phase decay curves are shown. The dotted line represents cells transfected with Cp-deficient pHBV and peYFP in the absence of Actinomycin D. The solid black line represents cells transfected with Cp-deficient pHBV and peYFP in the presence of Actinomycin D. The grey line represents cells transfected with Cp-deficient pHBV and peYFP-MOV10 in the presence of Actinomycin D. Data represent mean ± standard deviation from two independent experiments.

Journal: Viruses

Article Title: Effects of Moloney Leukemia Virus 10 Protein on Hepatitis B Virus Infection and Viral Replication

doi: 10.3390/v11070651

Figure Lengend Snippet: MOV10 over-expression does not induce the degradation of HBV pgRNA. 293T cells were transfected with HBV core-deficient plasmid (Cp-deficient pHBV) and peYFP-MOV10 or peYFP-empty (eYFP) plasmids. After 48 h, the cells were treated with 5 µg/mL Actinomycin D. The cells were harvested at 0, 2, 4, 6 h after Actinomycin D treatment. Total RNA was extracted and HBV pgRNA levels were determined relative to the 0 h time point. RPL18A mRNA was used as a normalization control. Single phase decay curves are shown. The dotted line represents cells transfected with Cp-deficient pHBV and peYFP in the absence of Actinomycin D. The solid black line represents cells transfected with Cp-deficient pHBV and peYFP in the presence of Actinomycin D. The grey line represents cells transfected with Cp-deficient pHBV and peYFP-MOV10 in the presence of Actinomycin D. Data represent mean ± standard deviation from two independent experiments.

Article Snippet: The plasmid harboring Cas9, guide-RNA (gRNA), and GFP (pCas9-GFP-Mov10_T1) was purchased from OriGene Technologies.

Techniques: Over Expression, Transfection, Plasmid Preparation, Standard Deviation

KEY RESOURCES TABLE

Journal: Cancer cell

Article Title: Eradication of Tumors through Simultaneous Ablation of CD276/B7-H3 Positive Tumor Cells and Tumor Vasculature

doi: 10.1016/j.ccell.2017.03.005

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Cd276 Gene Targeting in Cells using CRISPR/Cas9 DNA constructs encoding the following three guide-RNAs in the pCas-Guide-GFP expression vector were purchased from Origene: TGGCACAGCTCAACCTCATC, CTCGAAGCCCAGCATGACCC, CAGCATGACCCTGGAGCCCA.

Techniques: Purification, Plasmid Preparation, Recombinant, Electron Microscopy, Transfection, Blocking Assay, In Situ, Labeling, Western Blot, CRISPR, Expressing, Software